Abstract
Graphical abstract
Abstract
Sarcopenia is a very disabling age-related disease which affects the mass and strength of skeletal muscles. This syndrome has no efficient treatment and is associated with important oxidative stress which could play important role in skeletal muscle degeneration. In this context, the cytoprotective activity and the antioxidant properties of a polyphenol-rich plant extract (PRPE) were evaluated in undifferentiated C2C12 murine skeletal muscle cells (myoblasts). PRPE is a potent antioxidant mixture as shown by its reactive oxygen species (ROS) scavenging properties by using the Kit Radicaux Libres method and the dihydroethidium (DHE) scavenging assay. In addition, PRPE has significant protecting properties in C2C12 cells toward oxidative stress triggered by 2, 2′-azobis (2-amidinopropane) dihydrochloride (AAPH) which is an ROS generator, as measured by different complementary approaches. PRPE counteracts several AAPH-induced cytotoxic effects. PRPE prevents morphological changes evaluated by phase contrast microscopy and decreases the number of dying cells determined by counting in the presence of trypan blue and the intracellular ROS overproduction evaluated by flow cytometry after staining with DHE. In addition, PRPE tends to normalize the expression of genes (peroxiredoxin 1 (Pdrx1), nuclear factor erythroid 2-related factor 2 (Nrf2), and peroxisome proliferator-activator receptor gamma coactivator 1-alpha (Pgc1α)) involved in the oxidant stress defense under ROS exposure. Altogether; our data show that PRPE has potent antioxidant properties and protects C2C12 skeletal muscle cells toward AAPH-induced oxidative stress. These cytoprotective properties of PRPE in skeletal muscle cells submitted to a pro-oxidant environment deserve further investigation in the context of sarcopenia.
Introduction
Among age-related diseases, sarcopenia is defined as a combination of low muscle mass with low muscle function (Bautmans et al. 2009, Tournadre et al. 2019, Kim et al. 2021). This disabling disease, which mainly occurs in the elderly over 65 years old, is associated with important oxidative stress and with inflammation which are supposed to play key roles in its pathophysiology (Hammami et al. 2020, Chen et al. 2022, Pothier et al. 2022). Identifying pharmacological treatments is therefore a necessity. In this context, anti-inflammatory and antioxidant therapies could be of interest (Bautmans et al. 2009, Chhetri et al. 2018). Therefore, we studied on C2C12 skeletal muscle cells the cytoprotective effects of a polyphenol-rich plant extract (PRPE) which is a natural anti-oxidant formulation rich in flavonols, hydroxycinnamic acids and ascorbic acid (Aires et al. 2019). In a previous in vivo approach, Aires et al. chronically fed mice with a high-fat/high-sucrose diet compared to control mice fed with a normal chow diet (Aires et al. 2019). They showed that despite the persistence of obesity and adipose tissue hypertrophy, supplementation of the high-fat/high-sucrose diet with PRPE normalized the plasma lipid and lipopolysaccharide parameters, prevented macrophage recruitment, and reduced cholesterol and cholesterol oxide accumulation in the adipose tissue of obese mice. The healthier metabolic phenotype of PRPE-supplemented obese mice, as compared to non-supplemented obese mice, was supported by their extended median lifespan, which was similar to control, lean mice. In the context of sarcopenia, we studied the antioxidant properties of PRPE, and we were also interested to evaluate the cytoprotective effects of PRPE in C2C12 skeletal muscle cells. In order to induce oxidative stress on C2C12 cells, we used 2-2′-azo-bis-(2-amidinopropane) hydrochloride (AAPH) as a free radical generator (López-Alarcón et al. 2020). PRPE, which has antioxidant properties, was able to strongly attenuate AAPH-induced cytotoxic effects on C2C12 cells.
Materials and methods
PRPE characteristics
The composition of this extract previously described in Aires et al. is as follows (Aires et al. 2019). Active XXSTM supplied by Lara-Spiral (Couternon, France) includes antioxidant polyphenol-rich extracts from food plants (Asteraceae: Lactuca; Liliaceae: Allium cepa; Lamiaceae: Ajuga; and Verbenaceae: Lippia). XXSTM complies with regulations on food contaminants and banned and prohibited substances. The PRPE was analyzed by using HPLC with an HPLC-200 (Perkin Elmer) coupled to a diode array detector. Separation was performed using a linear gradient on a Licrospher 100 RP-18 column (150 × 4.6 mm; 5 μm, Merck) maintained at 27°C. The quaternary pump was connected to mobile phases: (A) consisting of pH 2.2 water containing trifluoroacetic acid and (B) consisting of acetonitrile. Twenty microliters of samples were injected into the chromatograph and the flow rate was 1 mL/min. Simultaneous monitoring was performed at 280 and 345 nm. The PRPE contains 25 g of polyphenols/100 g of extract (w/w), including 10 g/100 g of flavonoids (quercetin, 3.4 g/100 g and glycosylated quercetin, 5.1 g/100 g) and 15 g/100 g of hydroxycinnamic acids (chlorogenic acid, 0.5 g/100 g; chicoric acid, 5.1 g/100 g; and phenylpropanoid caffeic acid glycosides, 5.0 g/100 g).
Cell cultures and treatments
Murine C2C12 myoblasts were purchased from the European Collection of Cell Cultures (Sigma–Aldrich). C2C12 cells have the ability to differentiate in myotubes in particular culture conditions (Goto et al. 1999, Kaminski et al. 2012). In all experiments, C2C12 cells were seeded at 2500 cells/cm2 in Petri dishes (80 cm2). In all experiments, C2C12 cells were previously cultured for 24 h and further treated for 24 h in the presence of AAPH (5 mM) with or without PRPE (10 and 50 µg/mL) as previously described (Kaminski et al. 2012, Ghzaiel et al. 2021, Ghzaiel et al. 2022). Reactive oxygen species (ROS) were produced by the decomposition of AAPH. The initial solution of PRPE (20 mg/mL in DMEM) was prepared 8–12 h before the experiments, stirred overnight, and filtered (20 μm Millpore filter).
Microscopical evaluation of cell morphology by phase contrast microscopy
Cell morphology and cell density were observed and photographed after 24 h of treatment under an inverted phase-contrast microscope (Axiovert 40 CFL, Zeiss) equipped with a digital camera (Axiocam lCm1, Zeiss).
Evaluation of cell viability by cell counting with trypan blue
Cell viability was determined as previously described (Kaminski et al. 2012a ). At the end of the treatment, the supernatant was collected and the adherent cells were recovered by trypsinization with a trypsin/EDTA solution (Dutscher, Brumath, France). The suspensions containing supernatant and trypsinized cells were homogenized and used for counting viable cells using trypan blue (Dutscher) exclusion test.
Measurement of intracellular ROS by staining with dihydroethidium
The production of ROS, including the intracellular superoxide anion (O2 ●−) was quantified by flow cytometry after staining with dihydroethidium (DHE; Invitrogen/Thermo Fisher Scientific,Ghzaiel et al. 2021, 2022). Hydrogen peroxide (H2O2, 10 volumes) was used as a positive control. Adherent and non-adherent C2C12 cells were stained with a 2 μM DHE solution prepared in phosphate-buffered saline (PBS; 1X, pH 7.2) for 15 min at 37°C and then analyzed on ‘Partec Galaxy’, using FlowMax® software equipped with a 488 nm blue solid-state laser as the excitation source. Ethidium bromide fluorescence was measured in arbitrary units on a logarithmic scale on the FL2 channel with a 590/30 nm band pass filter (Nury et al. 2017).
Kit Radicaux Libres method
The antioxidant potential of PRPE was evaluated with the Kit Radicaux Libres (KRL; measurement of the overall antioxidant capacity) method (Prost 1989, Blache & Prost 1992,Lesgards et al. 2002, Rossi et al. 2013, Badreddine et al. 2017). Briefly, a defibrinated horse blood (Biomérieux, Craponne, France) was subjected to standardized oxidative stress using the azo-compound 2-2′-azo-bis-(2-amidinopropane) hydrochloride (AAPH) as the free radical initiator without or with PRPE. Several parameters were calculated from the time-dependent curve of AAPH-induced hemolysis. The time required to achieve 50% hemolysis (half-hemolysis time), measured by the optical density of hemoglobin (450 nm) or blood cells in suspension (620 nm), was determined (half-hemolysis time in min). For the present work, hemolysis was recorded using a 96-well microplate reader (KRL Test Reader, Kirial International, Couternon, France) by measuring the optical density decay at 620 nm. For each well, absorbance measurements were performed 75 times, once every 150 s.
Evaluation of the scavenging properties of plant-rich polyphenol extract
DHE was also used to evaluate the scavenging capacity of PRPE. To this end, AAPH (5 µM final concentration in PBS) was added to a 2 μM DHE solution prepared in PBS with and without PRPE (10 and 50 µg/mL). After 24 h of incubation in the dark at 37°C, the fluorescence was read on a Tecan fluorescence microplate reader (Tecan Infinite M200 Pro, Lyon, France).
RNA isolation and real-time quantitative PCR
The procedure used was similar to those described by Nicolas-Francès et al. (Nicolas-Francès et al. 2014). Total RNA from C2C12 myoblasts was extracted and purified using the RNeasy Mini Kit (Qiagen Courtaboeuf) with a 20 min DNAse treatment (Qiagen Courtaboeuf). Total RNA concentration was measured with TrayCell (Hellma Paris, France), and the purity of nucleic acids was controlled by the ratio of the absorbance 260 nm/280 nm (1.8–2.2). Quality control of RNAs and the lack of genomic DNA contamination were checked by agarose MOPS gel. One microgram total RNA was used for reverse transcription with the iScript1cDNA Synthesis Kit (Biorad, Life Science, Marnes-la-Coquette, France) according to the following reaction protocol: 5 min at 25°C, 1 h at 42°C, 5 min at 85°C, and hold at 4°C. cDNA was amplified using the MESA GREEN qPCR MasterMix Plus for SYBR1 Assay w/fluorescein (Eurogentec, Liege, Belgium). All PCR reactions were performed on an Applied Biosystem Step One QPCR machine (Life Technologies). Primers were designed to generate a PCR amplification product of 100–200 bp and were selected according to indications provided by PrimerBank (http://pga.mgh.harvard.edu/primerbank/). All primers were checked by DNA calculator (http://www.sigma-genosys.com/calc/DNACalc.asp) in case of any dimer or secondary structure formation. The 36B4 housekeeping gene was selected as a reference gene. PCR mix was realized with 300 nM of each primer, 12.5 mL MESA GREEN qPCR MasterMix Plus for SYBR1 Assay w/fluorescein and 5 mL of DNA in a 25 mL volume adjusted with RNase-free water. Each time, aliquots of the samples were pooled together to realize a serial dilution for establishing the standard curve. The specificity of the amplicon was evaluated by melting curves (from 60 to 95°C) and the efficiency (E) was assessed by standard curve (E = 10 (1/slope)) calculated by Step One software from a standard curve. All PCRs were performed on an Applied Biosystems StepOne QPCR (MeterTaq polymerase activation 20 s at 90°C, 40 cycles 3 s at 95°C, and 30 s at 60°C). The sequences of primers are presented in Table 1.
Primers used for RT-qPCR. 36B4 was used as the reference gene.
| Gene | Primer sequences | |
|---|---|---|
| Forward | Reverse | |
| Gpx | CCCTAGGAGAATGGCAAG | CAGAGTGCAGCCAGTAATCACCAAG |
| Nrf2 | TAGATGACCATGAGTCGCTTGC | GCCAAACTTGCTCCATGTCC |
| Pgc1-α | AGACGGATTGCCCTCATTTGA | TGTAGCTGAGCTGAGTGTTGG |
| Prdx1 | AATGCAAAAATTGGGTATCCTGC | CGTGGGACACACAAAAGTAAAGT |
| Sod1 | GACCTGGGCAATGTGACTGCTG | CACCAGTGTACGGCCAATGATG |
| Sod2 | ATTAACGCGCAGATCATGCAG | CTGAGTTGTAACATCTCCCTTGG |
| Ucp2 | CAAGTCTCCACGACCCATTT | TTCACAGCTGCCAGACAATC |
| Ucp3 | GCCTTCTCTCTCGGAGGTTT | GAGAGCAGGAGGAAGTGTGG |
| 36b4 | CGACCTGGAAGTCCAACTAC | ATCTGCTGCATCTGCTTG |
Statistical analyis
Data analyses were realized using a one-way ANOVA followed by Tukey’s multiple comparison test and/or by a Mann–Whitney test. P-values less than 0.05 were considered significant. To this end, GraphPad Prism 8.0 software (GraphPad Software).
Results
Cytoprotective activity of PRPE
The cytoprotective effect of PRPE on C2C12 cells was achieved after 24 h of co-treatment with PRPE (10 and 50 μg/mL) with the ROS generator (AAPH; 5 mM): C2C12 cells treated with AAPH (5 mM) for 24 h (T0 to T24) and co-treated for 24 h (T24 to T48) with AAPH associated or not with PRPE (10 and 50 µg/mL). In these conditions, the cytotoxicity was evaluated with morphological criteria by phase contrast microscopy and cell death was determined by counting in the presence of trypan blue. Our results show that PRPE protects C2C12 cells from AAPH-induced cell death: cytoprotective effects were only observed with PRPE used at 50 µg/mL (Fig. 1A and B). However, no cytoprotective effects were observed when PRPE was simultaneously used with AAPH from T0 to T48 (https://www.theses.fr/2012DIJOS092).
Cytoprotective effect of polyphenol-rich plant extract (PRPE) on AAPH-treated C2C12 cells. (A) Morphology of C2C12 cells evaluated by phase contrast microscopy after 24 h of treatment with AAPH (5 mM) with or without PRPE (10 and 50 µg/mL) (n = 3). (B) Cell counting of viable cells with trypan blue after 24 h of treatment of C2C12 cells with AAPH (5 mM) with or without PRPE (10 and 50 µg/mL) (n = 3). Control corresponds to untreated cells. Data are mean ± s.d. Data analysis was realized using a one-way ANOVA followed by Tukey’s multiple comparison test (*P < 0.05) and by a Mann–Whitney U test (#P < 0.05).
Citation: Redox Experimental Medicine 2023, 1; 10.1530/REM-23-0002
Antioxidant properties of PRPE
Three complementary approaches were used to evaluate the antioxidant properties of PRPE: the KRL method, the use of a DHE solution to determine the scavenging property of PRPE (‘scavenging test’), and the flow cytometric measurement of intracellular ROS in C2C12 cells cultured in the presence of AAPH (5 mM) with and without PRPE (10 and 50 µg/mL).
With the KRL method, AAPH (5 mM)-induced hemolysis of red blood cells was strongly reduced by PRPE demonstrating the ability of PRPE (10 and 20 µg/mL) to protect the cells when they were in a pro-oxidant environment: 50% hemolysis time of control (AAPH 5 mM), 76 ± 4 min; 50% hemolysis time of (AAPH + PRPE 10 µg/mL), 112 ± 6 min; 50% hemolysis time of (AAPH + PRPE 20 µg/mL), 151 ± 8 min (Fig. 2A). As PRPE strongly reduces hemolysis at 10 and 20 µg/mL, the effects of higher concentrations were not evaluated with the KRL assay. In addition, comparatively to AAPH (5 mM), the results obtained with the ‘scavenging test’ in the presence of DHE showed a decrease of DHE fluorescence when AAPH (5 mM) was associated with PRPE (50 µg/mL); however, no antioxidant effect was observed when PRPE was used at 10 µg/mL (Fig. 2B).
Antioxidant capacity of polyphenol-rich plant extract (PRPE) estimated with the KRL method and the scavenging assay with dihydroethidium. (A) KRL method, kinetic of hemolysis (KRL methods) of horse blood in the presence of AAPH (5 mM) (↑) associated with PRPE 10 µg/mL (↑) or 20 µg/mL (↑). The time required to achieve 50% hemolysis (half-hemolysis time in min) was determined by the optical density of red blood cells (erythrocytes) in suspension (620 nm). Hemolysis was recorded using a 96-well microplate reader (KRL Test Reader, Kirial International, France) to measure the optical density. (B) Scavenging assay with dihydroethidium (DHE). PBS, fluorescence of DHE (2 µM) diluted in PBS. Data are mean ± s.d. Data analysis was realized using a Mann–Whitney U test (#P < 0.05).
Citation: Redox Experimental Medicine 2023, 1; 10.1530/REM-23-0002
In addition, the antioxidant effects of PRPE (10 and 50 µg/mL) were also evaluated on C2C12 cells, after 24 and 48 h of co-treatment with AAPH (5 mM) associated with PRPE (10 and 50 µg/mL) (Fig. 3A and B). Compared to AAPH (5 mM)-treated cells, the results obtained show that DHE fluorescence of (AAPH (5 mM) + PRPE (50 µg/mL))-treated C2C12 cells was slightly decreased at 24 h (Fig. 3A) and significantly decreased at 48 h (Fig. 3B). At 24 and 48 h, no antioxidant effect was observed when AAPH (5 mM) was associated with PRPE (10 µg/mL) (Fig. 3A and B).
Flow cytometric evaluation with dihydroethidium (DHE) of the antioxidant activity of the polyphenol-rich plant extract (PRPE) on AAPH-treated C2C12 cells. After 24 h (A) or after 48 h (B) of co-treatment (AAPH (5 mM) with PRPE (10 and 50 µg/mL)), the intracellular ROS level was quantified by flow cytometry with DHE (n = 3). DMEM corresponds to untreated cells resuspended in DMEM without DHE (spontaneous fluorescence); DHE corresponds to untreated cells resuspended in DMEM in the presence of DHE; Hydrogen peroxide (H2O2, 10 volumes) was used as a positive control. Data are mean ± s.d. Data analyses were realized using a one-way ANOVA followed by Tukey’s multiple comparison test (*P < 0.05) and by a Mann–Whitney U test (#P < 0.05).
Citation: Redox Experimental Medicine 2023, 1; 10.1530/REM-23-0002
Effects of PRPE on the expression of genes associated with oxidative stress
A study of selected genes (Gpx, Nrf2, Pgc1-α, Prdx1, Sod1, Sod2, Ucp2, Ucp3) involved in anti-radical defenses was carried out on C2C12 cells treated with AAPH (5 mM) for 24 h and co-treated for 24 h with AAPH associated with PRPE (10 and 50 µg/mL). Gene expressions were obtained by comparing the threshold values (Cts). The results obtained show no significant result with Nrf2. However, Nrf2 expression tended to increase with AAPH and tended to decrease when AAPH was associated with PRPE. In addition, Prdx1 and Pgc1-α expressions increased with AAPH, and significant decreases in the expression of Prdx1 and PGC1-α (P < 0.05) were observed in a concentration-dependent manner when AAPH was associated with PRPE (Fig. 4). No significant variations (P < 0.05) were observed with the other genes studied (Gpx, Sod1, Sod2, Ucp2, Ucp3) (https://www.theses.fr/2012DIJOS092).
Measurement by RT-qPCR of the expression of genes (Prdx1, Nrf2, and PGC1-α) involved in anti-radical defenses on C2C12 cells treated with AAPH with and without polyphenol-rich plant extract (PRPE). C2C12 cells were treated for 24 h with AAPH (5 mM) with and without PRPE (10 and 50 µg/mL) (n = 3). Gene expression was expressed as fold induction vs control (Ghzaiel et al. 2021); data are mean ± s.d. Data analyses were realized using a one-way ANOVA followed by Tukey’s multiple comparison test (*P < 0.05) and by a Mann–Whitney U test (#P < 0.05). No significance was found at P < 0.01 and P < 0.001.
Citation: Redox Experimental Medicine 2023, 1; 10.1530/REM-23-0002
Discussion
Sarcopenia is characterized by inflammation (Bano et al. 2017, Pan et al. 2021) and significant oxidative stress which is considered to be a parameter that contributes to decreasing muscle mass and weakening muscle strength (Fanò et al. 2001, Foreman et al. 2021). To treat this highly debilitating age-related disease, it is therefore important to identify natural and synthetic molecules as well as mixtures of molecules, such as oils (Ghzaiel et al. 2021, 2022), preventing oxidative stress and restoring the RedOx balance in patients. To achieve this goal, C2C12 cells (murine myoblasts that can differentiate into myotubes) are often used. In the context of the identification of molecules that can help treat sarcopenia, we previously reported on C2C12 cells that α-tocopherol, a major component of Vitamin E (Rimbach et al. 2002), and Pistacialentiscus L seed oil were able to prevent ROS overproduction and cell death induction triggered by 7-ketocholesterol and 7β-hydroxycholesterol (Ghzaiel et al. 2021, 2022). These two cholesterol oxidative derivatives, mainly formed by cholesterol autoxidation, were identified at enhanced levels in the plasma of sarcopenic patients (Ghzaiel et al. 2021) and are often increased in patients with age-related diseases (Zarrouk et al. 2014, Ghzaiel 2022). A nutraceutical approach to the treatment of age-related diseases, including sarcopenia, has been favored for several years by our team and it is this guideline that led us to have an interest in PRPE. In addition, several polyphenols present in PRPE, such as resveratrol and quercetin, are now recognized for their senolytic properties which are attractive to fight aging and age-related diseases (Mbara et al. 2022). This aspect constituted an additional reason which motivated the evaluation of the cytoprotective and antioxidant activities of PRPE on AAPH-treated C2C12 cells.
According to the data obtained in the present study, PRPE has cytoprotective and antioxidant activities as shown by different complementary approaches.
The KRL method shows that PRPE is able to reduce AAPH-induced red blood cell hemolysis. It is important to underline that the concentrations of PRPE employed in the present study are based on the KRL test which was initially used to optimize the quantities of the different components of PRPE. The DHE scavenging assay shows that PRPE scavenges AAPH-induced ROS production. In addition, PRPE strongly and significantly reduces AAPH-induced intracellular ROS overproduction in C2C12 cells. In C2C12 cells, the ability of PRPE to attenuate oxidative stress is associated with cytoprotective activities shown by its ability to strongly and significantly attenuate AAPH-induced cell death. These in vitro data consolidate the interest of PRPE to treat sarcopenia even if the comparison of the different tests used at the moment does not provide sufficient answers on the mode of action of PRPE. Indeed, on C2C12 cells, PRPE only prevents AAPH-induced cell death at 50 µg/mL and not at 10 µg/mL, whereas at the concentrations of 10 and 20 µg/mL, with the KRL test, the hemolysis times were 25 and 50% higher, respectively, than with AAPH alone. In addition, the scavenging activity of PRPE was only found at 50 µg/mL. It was also the only concentration capable to prevent ROS overproduction at 48 h, and not at 24 h, on C2C12 cells. Altogether, our data support that the antioxidant properties of PRPE are not sufficient to explain the cytoprotection of this mixture.
Consequently, investigations of gene expression were realized to determine whether PRPE can modulate genes involved in free radical defense in a pro-oxidant environment mimicked by culturing C2C12 cells in the presence of AAPH. The data obtained provided information on the effect of PRPE on the expression of genes associated with AAPH-induced oxidative stress such as Prdx1, Nrf2 and PGC1-α. Peroxiredoxine 1 (Prdx1) is a member of the ubiquitous peroxiredoxin family of thiol peroxidases that catalyse the reduction of peroxides; peroxiredoxins are a critical component of cellular redox signaling, particularly in response to alterations in the production of H2O2 (Ledgerwood et al. 2017). Nuclear factor erythroid-2-related factor (Nrf2) is a transcriptional activator of antioxidative genes (superoxide dismutase (SOD), catalase, glutathione S-transferase, quinone oxidoreductase, heme oxygenase-1, thioredoxin reductase, and glutathione reductase); Nrf2 and its Kelch-like ECH-associated protein 1 (Keap1) have emerged as promising therapeutic targets (Ryu et al. 2021). Noteworthy, peroxisome proliferator-activated receptor gamma co-activator-1α (PGC-1α) is a superfamily of transcriptional co-activators which are essential to mitochondrial biosynthesis found in most cells including skeletal muscle; PGC-1α triggers mitochondrial biosynthesis associated with metabolic benefit in skeletal muscle (Vaughan et al. 2014). The data obtained in the presence of PRPE associated with AAPH support a nutrigenetic reprogramming of RedOx equilibrium. It is suggested that the antioxidant properties of PRPE asociated with its ability to favor normalization of gene expression (Prdx1, Nrf2 and PGC1-α) could play crucial roles in restablishing normal functions in skeletal muscle cells. As PRPE was previously reported to prevent obesity in mice (Aires et al. 2019), an in vivo activity of PRPE can also be expected for other diseases which may include sarcopenia.
Conclusion
In conclusion, our data show the antioxidant and cytoprotective properties of PRPE on different models. A pharmacokinetic study, taking into account the PRPE components and their metabolites in biological fluids and tissues is required to better know this plant extract and to optimize its use. Interestingly, the PRPE included in the mice diet (PRPE 3.72 g/kg diet) represents minute amounts in the digestive tract and even less in the blood and in the organs, taking into account of microbiota metabolism. Thus, it is probably hopeless to detect PRPE components. However, the effects are clearcut on animal survival. Indeed, PRPE 3.72 g/kg diet in male mice under a high fat-high sucrose diet strongly increases the median lifespan (Aires et al. 2019). Overall, the data obtained will permit to use a more sophisticated in vitro and in vivo models to clarify the mechanism of action of PRPE as well as its cell targets. The current data obtained on C2C12 cells open new perspectives to develop PRPE in the field of sarcopenia which has currently no effective treatment.
Declaration of interest
LARA-SPIRAL laboratories (Couternon, France) is a private company which conceived, designed and produces the antioxidant formulation ‘Active XXS Inside®’ so called ‘polyphenol-rich plant extract’ PRPE. These laboratories are also involved in the development, marketing and sales of the KRLTM method. Due to the 10-year confidential agreement between LARA SPIRAL and the Université de Bourgogne, the results described in the present publication, which are presented in the PhD Thesis of Dr Jacques Kaminski (defense : 20 December 2012), are only now published.
Funding
This study is a part of VITALIM’SENIORS and SYMPPA (SYndrome Métabolique PolyPhénols Activités), two Integrated Projects funded by the European Union (FEDER), French Government (ministeries of Budget and Industry), Regional Council (Bourgogne), General Departmental Councils (Yonne, Côte d’Or), Grand Dijon and Vitagora competitive cluster of Région Bourgogne. This work was supported by grants from the Université de Bourgogne, the Institut National de la Santé et de la Recherche Médicale (INSERM). We would like to thank SENAGRAL – Eurial Ultra Frais for providing additional funding and the partnership with the VITALIM’SENIORS and SYMPPA projects (LARA-SPIRAL, Couternon, France).
Author contribution statement
NL and MP proposed and designed the study. NL supervised the overall project. NL, MP and GL interpreted the data. NL and GL wrote the manuscript. JK MH and EPC performed the experiments and collected data. PD used the KRL method. MH and EPC analysed all experiments. This work is a part of the confidential PhD Thesis of JK successfully defended (20 december 2012) at the Université de Bourgogne, Dijon, France.
Acknowledgements
THe authors greatly acknowledge Dr Imen Ghzaiel (PhD, Post-Doc) for statistical analyses, illustration design, Mrs Anne Vejux (PhD, Ass. Prof.) and Mrs Nathalie Bancod for editing. The authors also acknowledge the NMS association (Nutrition Méditerranéenne et Santé/Mediterranean Diet and Health, http://anms.e-monsite.com/ ) which offers new perspectives for the development of the project.
References
Aires V, Labbé J, Deckert V, Pais De Barros JP, Boidot R, Haumont M, Maquart G, Le Guern N, Masson D, Prost-Camus E, et al.2019 Healthy adiposity and extended lifespan in obese mice fed a diet supplemented with a polyphenol-rich plant extract. Scientific Reports 9 9134. (https://doi.org/10.1038/s41598-019-45600-6)
Badreddine A, Zarrouk A, Karym EM, Debbabi M, Nury T, Meddeb W, Sghaier R, Bezine M, Vejux A, Martine L, et al.2017 Argan oil-mediated attenuation of organelle dysfunction, oxidative stress and cell death induced by 7-ketocholesterol in murine oligodendrocytes 158N. International Journal of Molecular Sciences 18. (https://doi.org/10.3390/ijms18102220)
Bano G, Trevisan C, Carraro S, Solmi M, Luchini C, Stubbs B, Manzato E, Sergi G & & Veronese N 2017 Inflammation and sarcopenia: A systematic review and meta-analysis. Maturitas 96 10–15. (https://doi.org/10.1016/j.maturitas.2016.11.006)
Bautmans I, Van Puyvelde K & & Mets T 2009 Sarcopenia and functional decline: pathophysiology, prevention and therapy. Acta Clinica Belgica 64 303–316. (https://doi.org/10.1179/acb.2009.048)
Chen M, Wang Y, Deng S, Lian Z & & Yu K 2022 Skeletal muscle oxidative stress and inflammation in aging: focus on antioxidant and anti-inflammatory therapy. Frontiers in Cell and Developmental Biology 10 964130. (https://doi.org/10.3389/fcell.2022.964130)
Chhetri JK, De Souto Barreto P, Fougère B, Rolland Y, Vellas B & & Cesari M 2018 Chronic inflammation and sarcopenia: A regenerative cell therapy perspective. Experimental Gerontology 103 115–123. (https://doi.org/10.1016/j.exger.2017.12.023)
Fanò G, Mecocci P, Vecchiet J, Belia S, Fulle S, Polidori MC, Felzani G, Senin U, Vecchiet L & & Beal MF 2001 Age and sex influence on oxidative damage and functional status in human skeletal muscle. Journal of Muscle Research and Cell Motility 22 345–351. (https://doi.org/10.1023/a:1013122805060)
Foreman NA, Hesse AS & & Ji LL 2021 Redox signaling and sarcopenia: searching for the primary suspect. International Journal of Molecular Sciences 22. (https://doi.org/10.3390/ijms22169045)
Ghzaiel I, Zarrouk A, Essadek S, Martine L, Hammouda S, Yammine A, Ksila M, Nury T, Meddeb W, Tahri Joutey M, et al.2022 Protective effects of milk thistle (Sylibum marianum) seed oil and α-tocopherol against 7β-hydroxycholesterol-induced peroxisomal alterations in murine C2C12 myoblasts: nutritional insights associated with the concept of pexotherapy. Steroids 183 109032. (https://doi.org/10.1016/j.steroids.2022.109032)
Ghzaiel I, Zarrouk A, Nury T, Libergoli M, Florio F, Hammouda S, Ménétrier F, Avoscan L, Yammine A, Samadi M, et al.2021 Antioxidant Properties and cytoprotective Effect of Pistacia lentiscus L. Seed oil against 7β-Hydroxycholesterol-Induced toxicity in C2C12 myoblasts: reduction in oxidative stress, mitochondrial and peroxisomal dysfunctions and attenuation of cell death. Antioxidants (Basel) 10. (https://doi.org/10.3390/antiox10111772)
Ghzaiel IS, K, Zarrouk A, Ghosh S, Dias IHK, Nury T, Ksila M, Essadek S, Tahri Joutey M, Brahmi F, et al.2022 Sources of 7-ketocholesterol, metabolism and inactivation strategies: food and biomedical applications. Redox Experimental Medicine 1 R40–R56. (https://doi.org/10.1530/rem-22-0005)
Goto S, Miyazaki K, Funabiki T & & Yasumitsu H 1999 Serum-free culture conditions for analysis of secretory proteinases during myogenic differentiation of mouse C2C12 myoblasts. Analytical Biochemistry 272 135–142. (https://doi.org/10.1006/abio.1999.4163)
Hammami S, Ghzaiel I, Hammouda S, Sakly N, Hammami M & & Zarrouk A 2020 Evaluation of pro-inflammatory cytokines in frail Tunisian older adults. PLoS One 15 e0242152. (https://doi.org/10.1371/journal.pone.0242152)
Kaminski J, Lançon A, Aires V, Limagne E, Tili E, Michaille JJ & & Latruffe N 2012 Resveratrol initiates differentiation of mouse skeletal muscle-derived C2C12 myoblasts. Biochemical Pharmacology 84 1251–1259. (https://doi.org/10.1016/j.bcp.2012.08.023)
Kim JW, Kim R, Choi H, Lee SJ & & Bae GU 2021 Understanding of sarcopenia: from definition to therapeutic strategies. Archives of Pharmacal Research 44 876–889. (https://doi.org/10.1007/s12272-021-01349-z)
Ledgerwood EC, Marshall JW & & Weijman JF 2017 The role of peroxiredoxin 1 in redox sensing and transducing. Archives of Biochemistry and Biophysics 617 60–67. (https://doi.org/10.1016/j.abb.2016.10.009)
Lesgards JF, Durand P, Lassarre M, Stocker P, Lesgards G, Lanteaume A, Prost M & & Lehucher-Michel MP 2002 Assessment of lifestyle effects on the overall antioxidant capacity of healthy subjects. Environmental Health Perspectives 110 479–486. (https://doi.org/10.1289/ehp.02110479)
López-Alarcón C, Fuentes-Lemus E, Figueroa JD, Dorta E, Schöneich C & & Davies MJ 2020 Azocompounds as generators of defined radical species: contributions and challenges for free radical research. Free Radical Biology and Medicine 160 78–91. (https://doi.org/10.1016/j.freeradbiomed.2020.06.021)
Mbara KC, Devnarain N & & Owira PMO 2022 Potential role of polyphenolic flavonoids as senotherapeutic agents in degenerative diseases and geroprotection. Pharmaceutical Medicine 36 331–352. (https://doi.org/10.1007/s40290-022-00444-w)
Nicolas-Francès V, Arnauld S, Kaminski J, Ver Loren Van Themaat E, Clémencet MC, Chamouton J, Athias A, Grober J, Gresti J, Degrace P, et al.2014 Disturbances in cholesterol, bile acid and glucose metabolism in peroxisomal 3-ketoacylCoA thiolase B deficient mice fed diets containing high or low fat contents. Biochimie 98 86–101. (https://doi.org/10.1016/j.biochi.2013.11.014)
Nury T, Zarrouk A, Ragot K, Debbabi M, Riedinger JM, Vejux A, Aubourg P & & Lizard G 2017 7-ketocholesterol is increased in the plasma of X-ALD patients and induces peroxisomal modifications in microglial cells: potential roles of 7-ketocholesterol in the pathophysiology of X-ALD. Journal of Steroid Biochemistry and Molecular Biology 169 123–136. (https://doi.org/10.1016/j.jsbmb.2016.03.037)
Pan L, Xie W, Fu X, Lu W, Jin H, Lai J, Zhang A, Yu Y, Li Y & & Xiao W 2021 Inflammation and sarcopenia: a focus on circulating inflammatory cytokines. Experimental Gerontology 154 111544. (https://doi.org/10.1016/j.exger.2021.111544)
Pothier K, Gana W, Bailly N & & Fougère B 2022 Associations between frailty and inflammation, physical, and psycho-social health in older adults: a systematic review. Frontiers in Psychology 13 805501. (https://doi.org/10.3389/fpsyg.2022.805501)
Rimbach G, Minihane AM, Majewicz J, Fischer A, Pallauf J, Virgli F & & Weinberg PD 2002 Regulation of cell signalling by vitamin E. Proceedings of the Nutrition Society 61 415–425. (https://doi.org/10.1079/pns2002183)
Rossi R, Pastorelli G & & Corino C 2013 Application of KRL test to assess total antioxidant activity in pigs: sensitivity to dietary antioxidants. Research in Veterinary Science 94 372–377. (https://doi.org/10.1016/j.rvsc.2012.08.005)
Ryu J, Gulamhusein H, Oh JK, Chang JH, Chen J & & Tsang SH 2021 Nutrigenetic reprogramming of oxidative stress. Taiwan Journal of Ophthalmology 11 207–215. (https://doi.org/10.4103/tjo.tjo_4_21)
Tournadre A, Vial G, Capel F, Soubrier M & & Boirie Y 2019 Sarcopenia. Joint Bone Spine 86 309–314. (https://doi.org/10.1016/j.jbspin.2018.08.001)
Vaughan RA, Mermier CM, Bisoffi M, Trujillo KA & & Conn CA 2014 Dietary stimulators of the PGC-1 superfamily and mitochondrial biosynthesis in skeletal muscle. A mini-review. Journal of Physiology and Biochemistry 70 271–284. (https://doi.org/10.1007/s13105-013-0301-4)
Zarrouk A, Vejux A, Mackrill J, O'callaghan Y, Hammami M, O'brien N & & Lizard G 2014 Involvement of oxysterols in age-related diseases and ageing processes. Ageing Research Reviews 18 148–162. (https://doi.org/10.1016/j.arr.2014.09.006)
